A MOPD II-associated Pericentrin variant disrupts PACT domain dimerization and pericentriolar material recruitment

Makenzie S. Thomas; Brian J. Galletta; John M. Ryniawec; Anastasia Amoiroglou; Chaitali Khan; Carey J. Fagerstrom; Gregory C. Rogers; Nasser M. Rusan

Abstract

Centrosome dysfunction is linked to developmental disorders affecting brain and body size, including microcephaly and primordial dwarfism. However, the cellular mechanisms underlying these rare conditions remain poorly understood. In this study, we investigate a rare variant of the centrosome-associated protein Pericentrin, which was discovered in a single family with Majewski/microcephalic osteodysplastic primordial dwarfism type II (MOPD II). Unlike the majority of pathogenic PCNT variants that cause severe protein truncation, the p.Lys3154del variant (ΔK3154) involves a single amino acid deletion in the protein's only conserved functional domain, providing a unique opportunity to explore PCNT function in MOPD II. To model PCNTΔK3154, we examined the effects of Drosophila Pericentrin-like protein (PLP) carrying an orthologous deletion (PlpΔR). Our results show that plpΔR animals exhibit smaller tissues that recapitulate MOPD II phenotypes. Behavioral assays revealed defects in climbing and mechanosensation, suggesting impaired sensory cilia function. We also found that PlpΔR cells exhibit accelerated mitosis, increased apoptosis, and reduced pericentriolar material recruitment. In silico structural modeling, yeast two-hybrid, and coimmunoprecipitation experiments show that PlpΔR produces a protein that disrupts PLP dimerization and PLP interaction with Asterless, another centrosome protein. Overall, modeling the human MOPD II patient variant PCNTΔK3154 in Drosophila reveals how a single amino acid deletion affects biological processes from the molecular level to the organismal level. Our work offers new insights into the defective cellular mechanisms underlying MOPD II in patients with the PCNTΔK3154 variant, potentially linking the etiology of the disease in these individuals to the loss of a single protein-protein interaction.

obvious gross spindle abnormalities or chromosome segregation errors. This is surprising given that PCNT mutant cells, including those from MOPD II patients, often display spindle abnormalities and chromosome missegregation. However, it is worth noting that the wing disc cells are extremely small, making it difficult to observe subtle mitotic errors. Additionally, it is possible that the accelerated mitosis we observed bypasses checkpoints that would normally detect such errors, or that errors do occur but are not visible under our imaging conditions. It is also possible that the cell death we observe is not directly caused by spindle/chromosome errors but rather represents a more general, indirect consequence of the cellular stress imposed by the PlpΔR mutation. Molecular insights into PlpΔR pathogenesis Our in silico, biochemical, and cell biological studies revealed that the single amino acid deletion in the PACT domain of PLP disrupts multiple aspects of protein function. Specifically, we found that PlpΔR disrupts: 1) PACT domain dimerization, 2) interaction with Asterless, and 3) reduced PCM recruitment. These defects occur at the molecular level despite only a 35% reduction in PLP protein localization at centrosomes. This is an important observation because it indicates that loss of a specific protein-protein interaction is the primary driver of the cellular phenotypes we observe, rather than a general loss of PLP protein at the centrosome. The PACT domain and its function in protein dimerization The PACT domain, found in PCNT and AKAP450, serves as a calmodulin-binding localization domain and is required for centrosome targeting (Gillingham and Munro, 2000; Takahashi et al., 2002). While the PACT domain is known to be involved in protein localization, its role in forming dimers or higher-order assemblies has not been previously characterized. Our structural modeling and biochemical studies demonstrate for the first time that the PACT domain can form coiled-coil dimers. This finding extends the known structural and functional properties of the PACT domain and has implications for understanding how PCNT organizes PCM and other cellular structures. A model for how PlpΔR causes disease Based on our molecular and cellular findings, we propose a model (Fig. 8) for how the PCNT Lys3154 deletion (human) and the orthologous PlpΔR (Drosophila) disrupts Pericentrin function and contributes to MOPD II pathogenesis. In wild-type cells, PCNT/PLP localizes to the centriole, in part through its highly conserved PACT domain. The PACT domain likely forms homodimers (and possibly higher-order assemblies) via a parallel coiled-coil structure. This coiled-coil dimerization allows for proper spacing and orientation of the PLP molecules on the centriole surface, which facilitates downstream recruitment of centrosome and centriole-associated proteins, such as Asterless. Asterless, in turn, is a known hub protein that recruits additional centrosome components and PCM proteins, including Centrosomin, to the centrosome. When the Lys/Arg residue is deleted, the coiled-coil structure is disrupted, which prevents proper dimer formation. This in turn, disrupts the ability of PLP to interact with Asterless, reducing the recruitment of PCM components like Centrosomin to the centrosome. Reduced PCM assembly results in compromised centrosome function, leading to cellular defects including accelerated mitosis, increased apoptosis, and ultimately reduced tissue and organismal growth. This model explains why only a 35% reduction in total PLP protein at the centrosome leads to significant cellular and organismal phenotypes — the problem is not that there is less total protein, but that the protein present is not functioning properly due to the loss of critical protein-protein interactions. This work represents a clear example of how loss of a single amino acid can have profound effects on protein function and ultimately on human health and development. Methods 624 Drosophila Stocks and Transgenic Lines We used standard Drosophila husbandry and stocks from the Bloomington Drosophila Stock Center (BDSC) and from the Vienna Drosophila Resource Center (VDRC). Transgenic fly lines were generated or used as previously described. Stocks included: w1118 (wild-type control), Plp2172/TM3 (null mutant (Galletta et al., 2014)), ubi-Plp::GFP (Galletta et al., 2014), PlpBAC (Genomics Resource Center, DGRC), and Df(3L)Brd15 (deletion mutant, BDSC). All flies were reared at 25°C under standard light/dark cycles unless otherwise noted. Details of all antibodies and reagents used in this study are provided in Table S1.

Drosophila Stocks and Transgenic Lines

We used standard Drosophila husbandry and stocks from the Bloomington Drosophila Stock Center (BDSC) and from the Vienna Drosophila Resource Center (VDRC). Transgenic fly lines were generated or used as previously described. Stocks included: w1118 (wild-type control), Plp2172/TM3 (null mutant (Galletta et al., 2014)), ubi-Plp::GFP (Galletta et al., 2014), PlpBAC (Genomics Resource Center, DGRC), and Df(3L)Brd15 (deletion mutant, BDSC). All flies were reared at 25°C under standard light/dark cycles unless otherwise noted. Details of all antibodies and reagents used in this study are provided in Table S1.

We also observed a faster progression through mitosis (NEB to AO), which could explain part of the decreased mitotic index. It is possible that cell death is a downstream consequence of the accelerated mitosis that leads to errors in chromosome segregation, which then triggers apoptosis. The shortened mitosis could implicate a defective spindle assembly checkpoint (SAC) or premature activation of the anaphase-promoting complex (APC) (Musacchio, 2015). There are phenotypic similarities between PlpΔR and SAC mutants. In the fly, both accelerated mitosis and increased cell death are seen in the brain of mutants in the SAC protein bub1 (Basu et al., 1999). In mammals, dominant negative Bub1 causes an accelerated exit from mitosis (Taylor and McKeon, 1997) and depletion of an Mad2, another SAC protein, caused cells to enter anaphase prematurely (Gorbsky et al., 1998). Finally, there are many similarities between patients with variants in PCNT and SAC, including at the cellular level. Mutations in SAC proteins, including BUBR1, BUB3 and TRIP13, are linked to Mosaic Variegated Aneuploidy (MVA) syndrome, which causes a variety of phenotypes that overlap with MOPD II, including microcephaly, developmental delay, growth limitation, and short stature (de Voer et al., 2013; de Wolf et al., 2021; Hanks et al., 2004; Matsuura et al., 2006; Snape et al., 2011; Yost et al., 2017). Cells from patients with MVA have aneuploidy in a wide range of cell types and have premature sister chromatid separation (PCS) (Hanks et al., 2004; Matsuura et al., 2006). Mitotic spreads of MOPD II (PCNT deficient) patient peripheral lymphocytes also have “low-level” MVA and PCS, which lead Rauch et al. to propose a link between PCNT/MOPDII and SAC/MVA (Rauch et al., 2008). Since then, MVA syndrome has been linked to other centrosome proteins, Cep57 and CCDC84 (CENTAC) (de Voer et al., 2013; de Wolf et al., 2021;

Snape et al., 2011; Yost et al., 2017). In total, this data suggests a link between the centrosome, PLP/PCNT specifically, and SAC that merits future investigation and could underly the shortened mitosis we observed.

PlpΔR provides insights into the PACT domain and its function in PLP

The combination of our fly model, in silico modeling, and in vitro studies provide important insight into how the Pericentrin PACT domain functions at the centriole (Fig. 7F). Our in silico and co-IP data indicate that the PACT domain forms a multimer, likely a dimer, that facilitates binding to CaM. PLPΔR disrupts coiled-coil formation within the PACT domain, and reduces, although does not eliminate, the ability of PACT to interact with CaM. This is consistent with our previous observations that missense mutations in CBD1 did not disrupt PLP C-terminal binding to CaM (Galletta et al., 2014), as it could still bind PACT via CBD2. However, deletion of the entire CBD1 domain had a much more potent effect as it eliminated CaM binding completely, likely due to disruption in PACT’s ability to dimerize. Collectively, we conclude that CBD1 of PACT is critical for dimerization, and dimerization enhances CaM binding to CBD2, possibly due to a dimerization-induced conformational change in PACT that places CBD2 in an optimal position to bind CaM, all of which was supported by AlphaFold3 predictions.

We show that PLPΔR prevents phosphorylation of PACT and significantly reduces the interaction between the C-terminus of PLP and the bridge protein Asterless/Asl. We propose that the loss of the PLP-Asl interaction has two downstream consequences: first, it leads to a reduction in the amount of PLP at the centriole, although this could be a result of a reduction in total PLP levels. Second, the loss of the PLP-Asl interaction reduces Centrosomin/Cnn levels at the centrosome. These results lead us to hypothesize that the PLP-Asl interaction is important within the bridge zone of the centriole to recruit and build a robust PCM. (Fig. 7F). The precise interplay between PACT dimerization, CaM binding, and PACT phosphorylation on the PLP-Asl interaction is not fully understood at this point (Fig. 7F, blue box showing molecular species). This important future work will require additional extensive molecular dissection.

Summary

In summary, modeling the human MOPD II patient variant, PCNTΔK3154, in Drosophila revealed how a single amino acid deletion affects biological processes from the molecular level to the organismal level. We identified several phenotypes that closely model MOPD II symptoms including tissue growth defects and sensory impairments. At the cellular, organelle, and molecular levels, we have identified that PLPΔR alters mitotic timing, increases apoptosis, impairs centrosomal protein recruitment, and disrupts key protein-protein interactions, providing new insights into the potential etiology of MOPD II in patients with this unique PCNT variant. With PCNT being a large protein, able to interact with many proteins, we hypothesize that other MOPD II variants from patients might disrupt other critical protein interactions. The loss of different interactions could result in similar loss of function phenotypes in some cellular contexts, but different phenotypes in others. This could provide some explanation for the variation in clinical presentation seen across MOPDII patients. Future directions of this work will follow-up on the MOPD II p.Lys3154del variant with the exiting prospect of designing or screening for interventions that would rescue the PACT-Asl interaction.

Fly stocks

D. melanogaster were maintained on Bloomington Recipe Fly Food (Lab Express, Ann Arbor, MI). Crosses were performed at 25ºC unless otherwise described. All control (wild-type) flies used in this study are yw or w1118. The following strains were used: Plp2172 (Spradling et al., 1999), Df(3L)Brd15 (Bloomington Drosophila Stock Center, Bloomington, IN, USA, #5354), H2A::RFP (His2AvD::mRFP) (Pandey et al., 2005), ubi-tubulin:GFP (Gift from Tomer Avidor-Reiss Lab), UAS-Ana1::tdtomato (Blachon et al., 2009), ubi-Plp::GFP (Galletta et al., 2014) and BAC-Plp (transgenic line carrying a BAC that duplicates the region around Plp; Bloomington Drosophila Stock Center, #90069).

Fly cell culture

Drosophila S2 cells (Invitrogen) were cultured in Sf-900II SFM media (Life Technologies) supplemented with penicillin/streptomycin. DNA plasmid was transfected into S2 cells by nucleofection. Briefly, ∼5 × 10⁶ cells were pelleted by centrifugation. Cell pellet was resuspended in 100 µl of transfection solution (5 mM KCl, 15 mM MgCl2, 120 mM sodium phosphate, and 50 mM D-mannitol, pH 7.2) containing 2 µg of purified plasmid, transferred to a cuvette (2 mm gap size), and then electroporated using a Nucleofector 2b (Lonza), program G-030. Transfected cells were diluted immediately with 0.4 mL SF-900 II medium and plated in a 6-well cell-culture plate containing 1 mL of fresh media. Cells were allowed 24 hours to recover before additional handling. Expression of the construct was induced by the addition of 0.25 mM CuSO4 to the culture medium. Transfected cells were used 24 hours after induction.

Plasmids and molecular cloning

The CRISPR repair template was cloned into pUC backbone with Gibson assembly using primers:

PLP gDNA Forward:

GTACTTCGCGAATGCGTCGAGATACCAATGACCGACGACGAGAACTTCACTGGCGAGCGG PLP gDNA Reverse:

CTCGTCGGTCCCGGCATCCGATCCAATAGGATGATGCCGCGCATGCGCTCTTTTTGGTTT Site directed mutagenesis was performed to remove R2720 from the repair template using primers:

PLP ΔR2720 mutagenesis Forward: GCTGGTCTACCAGAAGTATTTGAAGCTCACAC

PLP ΔR2720 mutagenesis Reverse:

GTGTGAGCTTCAAATACTTCTGGTAGACCAGC Site directed mutagenesis was performed to silently remove a StuI enzyme cleavage site ~300 bp upstream of R2720 from the repair template using primers:

PLP StuI mutagenesis Forward: GCCAAACTAGCTGAGGCCTTAGCTCAGGC

PLP StuI mutagenesis Reverse: GCCTGAGCTAAGGCCTCAGCTAGTTTGGC

Site directed mutagenesis was performed to remove the PAM of the gRNA site from the repair template using primers:

PLP gRNA PAM mutagenesis Forward:

CACTGGAAGGTTACCAAGCCAGTGAGCAATTGG PLP gRNA PAM mutagenesis Reverse:

CCAATTGCTCACTGGCTTGGTAACCTTCCAGTG Primers for cloning the PLP ΔR2720 gRNA into pU6-BbsI-chiRNA vector (Gratz et al., 2013) were:

PLP ΔR2720 gRNA Forward: CTTCGCTCACACTGGAAGGTTACC

PLP ΔR2720 gRNA Reverse: AAACGGTAACCTTCCAGTGTGAGC

Lentiviral mNG-HsPACT (PCNT aa. 3102-3336) plasmid was ordered from Twist Biosciences. mNG-HsPACT-ΔK3154 was generated through PCR mutagenesis of mNG-HsPACT with primers:

ΔK3154-F: gctctgatttatcaaaagtatcttttgctgttgattgg

ΔK3154-R: ccaatcaacagcaaaagatacttttgataaatcagagc

Generation of CRISPR flies

PlpΔR2720 was generated by homologous recombination using CRISPR (Gratz et al., 2013). (Fig. 1F). y^[1]M(vas-Cas9)ZH-2A w^[1118]/FM7c (Bloomington Drosophila Stock Center, #51323) flies were crossed to PLP::mNeon CRISPR line (Galletta et al., 2020). The progeny were injected with pU6-Bbsl-chiRNA containing the PlpΔR2720 gRNA and the repair template (BestGene; Chino Hills, CA). Recombinants were identified by screening PCR products amplified from potential recombinants for loss of digestion by StuI. Counter-screening found this recombinant was untagged and did not contain mNeon.

Brain volume measurements

Adult female flies aged 4–6 days were collected from the respective genotypes cultured at either 25 °C or 15 °C. Flies were anesthetized, and their heads were separated using dissection forceps, then placed in 4% formaldehyde solution for 15–20 minutes at room temperature. Following this, fly brains were dissected and further fixed for an additional 20 minutes in 4% formaldehyde at room temperature. After fixation, the solution was removed and the dissected brains were incubated in 1× PBS for 30 minutes to ensure removal of any residual fixative. The brains were then incubated in blocking buffer (0.1% PBST with 0.5% BSA) for 1 hour at room temperature, followed by overnight (O/N) incubation with primary antibody at 4 °C. The next day, samples were washed three times with 0.1% PBST and incubated with the appropriate secondary antibody for 2 hours at room temperature, followed by three washes with 0.1% PBST. Samples were then stained with nuclear stain (NuclearMask, Invitrogen H10325, 1:2000 dilution) for 15 minutes, followed by PBST washes. Phalloidin-Atto-647 (Sigma 65906, 1:1000) was then added for 15 minutes, followed by a PBST wash. Finally, samples were washed in 1× PBS to remove any residual Triton. Samples were mounted on glass slides using 0.12 µm depth Secure-Seal Imaging Spacers (Grace Bio-Labs 654008) in Aqua-Poly/Mount (Polysciences 18606-5). Slides were cured at room temperature overnight before imaging. The phalloidin channel was used to perform volumetric analysis across different genotypes. Full Z-stacks were imported into Imaris 10.2.0 version software, 3D volumes were rendered using the surpass volume rendering module. Volumetric measurements in µm³ were obtained from the statistics tab.

Bang assay

Bang assays were performed using a previously described modified protocol (Inagaki et al., 2010). The apparatus was 3D printed and consists of an upper and lower frame with five circular indentations into which plastic fly vials (25 mm diameter x 95 mm height) are inserted. The openings of the vials in each frame are faced towards each other and connected by a third frame containing a manual sliding gate mechanism, allowing flies to move freely between the upper and lower vials when open. In brief, 15-30 male flies were collected one day after eclosion under ice anesthesia and transferred to a fresh culture vial. Flies were placed in a dark room for 1-3 hours to recover from anesthesia and acclimate to darkness. To perform behavioral assay, flies were transferred to the lower vial of the apparatus with the sliding gate closed. For each trial, the apparatus was forcefully banged down onto a rubber mat three times to agitate flies and induce strong negative gravitaxis. The apparatus allows for five genotypes to be tested simultaneously to control for variability in agitation force. Immediately after agitation, the sliding gate was opened for 1 min to allow flies to climb from the lower to upper vial. Afterwards, the sliding gate was closed and the number of flies that had climbed the approximately 95 mm into the upper vial was recorded. Flies were given a 5 min recovery period after each trial and repeated for five trials. As a negative control, wild-type flies were collected one day prior to experiment, anesthetized on ice, and aristae in the third antennal segment were removed using fine forceps or iridectomy scissors, referred to herein as ablation. Flies were transferred to a fresh culture vial containing a moistened Kimwipe tent. The second antennal segments containing Johnston’s organs were carefully unperturbed to prevent a compensated gravity response. All experiments were performed between 70-73°C and 30-32% ambient humidity. To determine if the defects seen in this assay were a result of climbing issues, and not solely a result of defects in gravity sensation, these experiments were repeated with a light above the apparatus to induce phototaxis, which should be independent of gravity sensation.

Mechanosensation assay

Mechanosensation assays were performed using a previously described, modified protocol (Murphy et al., 2015). In brief, flies were collected on the day of eclosion, anesthetized on ice, and decapitated with iridectomy scissors. Decapitation is necessary to prevent adults from flying away when stimulated. Headless flies were placed in a closed, moist chamber and allowed approximately 10-20 hours of recovery. After the recovery period, only flies that right themselves when perturbed were used for further testing. All experiments were performed within 24 hours of decapitation. On the testing day, flies were visualized under a dissecting microscope and a grooming reflex was elicited by deflecting either the notopleural or postalar bristles towards the fly body with a stiff paintbrush or fine forceps. The leg grooming response was given a score of one for flies that lifted their leg in response to bristle stimulation and a score of zero to flies that did not move their legs. For each fly, bristles were stimulated up to three times per trial with five total trials spaced 2 min apart.

Immunofluorescence

Imaginal discs and testes were dissected, from developmentally staged third-instar larvae or adult males respectively, in Schneider’s medium (ThermoFisher Scientific, Waltham, MA, USA) with antibiotic-antimycotic (ThermoFisher Scientific, Waltham, MA, USA), and fixed in 9% formaldehyde in PBS at room temperature for 20 min. Fixed samples were washed 3 times in PBS + 0.3% Triton X-100 (PBST) and blocked for 2-4 hours in PBST + 5% normal goat serum (NGS). Samples were incubated in primary antibodies in PBST + 5% NGS overnight at 4ºC. After 3 x 10 min washes in PBST, samples were incubated for 2 hours at room temperature with secondary antibodies. Samples were finally washed 3 x 10 min in PBST and mounted in AquaPolymount (Polyscience, Inc., Warrington, PA, USA) underneath a #1.5 coverslip.

For Johnstons Organ’s antennae were dissected from pupae ~60 – 70 hours after pupariation. Fixation, staining and mounting were as for other tissues. Primary antibodies used were rabbit anti-PLP (1:5000) (Rogers et al., 2008), guinea pig anti-Asterless (1:10,000; gift from G. Rogers, University of Arizona Cancer Center, University of Arizona, Tucson, AZ, USA), rabbit anti-Centrosomin (1:10,000; gift from T. Megraw, Florida State University, Tallahassee, FL; USA), rabbit anti-phospho-histone H3 (1:1000; MilliporeSigma, Burlington, MA, USA), rabbit anti-cleaved DCP-1 (1:200; Cell Signaling Technology, Danvers, MA, USD), mouse anti- γH2Av (1:100; Developmental Studies Hybridoma Bank, UNC93-5.2.1-s) and rat anti-Deadpan (1:100; Abcam, Cambridge, UK). Secondary antibodies labeled with Alexa Fluor 488, 568, or 647 were used at 1:1000 (ThermoFisher Scientific). Phalloidin and DAPI (1:1000; ThermoFisher Scientific) was added to secondary antibodies.

Microscopy

Confocal images were collected using a Nikon Eclipse Ti2 (Nikon Instruments, Melville, NY, USA) with a Yokogawa CSU-W1 spinning disk confocal head (Yokogawa, Life Science, Sugar Land, TX, USA) equipped with a Prime BSI cMOS camera (Teledyne Photometrics, Tucson, AZ, USA) and Nikon Elements software (Nikon Instruments). Adult wings and heads were imaged with a 4X air objective. Wing discs were imaged with a 100x TIRF/1.49 NA oil immersion objective for centrosome-specific measurements and a 40x/1.30 NA oil objective for mitotic index measurements. Johnston’s organs were imaged with a 100x TIRF/1.49 NA oil objective on a Nikon Eclipse Ti (Nikon Instruments) with a Yokogawa CSU-X1 spinning disk confocal head (Yokogawa, Life Science) equipped with an Kinetix22 camera (Teledyne Photometrics, Tucson, AZ) and Nikon Elements software (Nikon Instruments). For adult brain volumetric analysis samples were imaged on a Zeiss LSM 880 confocal microscope using a 20×/0.8 NA objective with Zen software. For wing disc measurements, Z-stacks encompassing the entire tissue volume were collected by acquiring optical slices spaced by 200 nm; these data are presented as maximum intensity projections. 405, 488, 561, and 641 nm laser lines were used on all systems. All images were analyzed and processed using Fiji (Image J, National Institutes of Health, Bethesda, MD, USA) unless noted.

S2 cell imaging was performed using a CSU-W1 SoRa Yokogawa spinning-disk field scanning confocal system assembled on an ECLIPSE Ti2 inverted microscope (Nikon) with a Kinetix sCMOS 10MP camera (Photometrix) with a 100x (Silicone Plan Apo, NA = 1.35) objective.

Fluorescence measurements

Centriole protein measurements were performed as previously described (Galletta et al., 2014). Samples and a corresponding control were prepared and imaged on the same day. Fixed wing disc and brain samples were stained with anti-PLP, anti-Asl, and anti-Cnn to label centrioles and DAPI to label metaphase nuclei. Sum projections of the entire Z volume of the centriole were generated, an ROI was drawn around the centriole using the asterless label for reference, and the total integrated density was measured. An identically sized ROI adjacent to the centriole was measured for background subtraction. All fluorescence measurements were normalized to the mean value of the yw or w1118 control on a given day. The Centrosomin signal was carefully outlined for each centriole and the circularity shape descriptor was measured.

Wing disc mitotic index measurements were performed as previously described (Handke et al., 2014). All samples were prepared and imaged on the same day. Fixed wing disc samples were stained with anti-phospho-histone H3 (PH3) to label cells undergoing mitosis with DAPI and phalloidin to delineate all individual cells. A first focal plane of the wing discs was acquired at the peripodial membrane. Additional optical slices with 200 nm spacing were acquired in the direction towards the basal side of the disc epithelium. Maximum intensity projects of each z stack were generated using Fiji to produce 2D images. The area defined by the pouch and hinge regions of the wing discs was outlined and a mask was applied in the channel containing PH3-positive nuclei. The area occupied by PH3-positive nuclei was divided by the total area of the combined pouch and hinge region to describe a mitotic index of the tissue. To quantify cell death, the same method was employed as previously described except fixed wing disc samples were stained with anti-cleaved DCP-1 to label cells undergoing apoptosis.

Wing disc western blots

For analysis of PLP levels by Western blot. 30 wing discs from crawling third instar larvae were dissected in Schneider’s media with antibiotic-antimycotic and homogenized in 50 µLof RIPA buffer (10 mM Tris-HCl, pH 7.5, 140 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 1% Triton X-100, 0.1% sodium deoxycholate, 0.1% sodium dodecyl sulfate). 10 µL of 6X SDS-sample buffer (350 mM Tris pH 6.8, 30% glycerol, 10% SDS, 600mM DTT, ~0.05% Bromophenol Blue) was added and samples were incubated for 5 min at 95°C, then samples were stored at -80°C until use. All of each sample was run on a 1.5mm thick 5% SDS-polyacrylamide gel. Samples were then transferred to Polyvinylidene fluoride (PVDF) membrane using Tris-Base Glycine transfer buffer (Novex) with 20% methanol. Blots were blocked in 5% nonfat dry milk diluted in TBST (0.1% Tween 20 diluted in Tris Buffered Saline—50-mM Tris-HCl, pH7.5, 150-mM NaCl) for 30–60 min before incubation with primary antibody - Rabbit anti-PLP (N-terminus, (Rogers et al., 2008); 1:2000) - diluted in block overnight at 4°C. Blots were rinsed 3X, then washed 3 x 10 minutes in TBST. Secondary antibody (anti-Rabbit horseradish peroxidase (HRP) conjugated 1:5000; ThermoFisher) in block for at least 2.5 hours at RT. Blots were rinsed 3X, then washed 3 x 10 minutes in TBST. Detection used SuperSignal West Dura Extended Duration Substrate (Life Technologies) and an Amersham ImageQuant 800 (Cytiva). To assess loading, blots were stripped with Restore Wesern Blot Stripping Biffer (ThermoFisher) and reprobed with anti-α spectrin (1:50; 3A9; Developmental Studies Hybridoma Bank) and anti-mouse-HRP (1:5000; ThermoFisher) as above. For quantification, “total integrated density” of bands were measured in ImageJ and background from a region of the same size, adjacent to the that band was subtracted. Normalization was first to the loading control (α-Spectrin) and then to the control PLP band of that experiment. Mean ± standard deviation of three independent experiments is presented.

Live imaging

For live imaging of wing discs, crawling third-instar larvae were dissected in Schneider’s medium with antibiotic-antimycotic. Wing discs were mounted in a drop of Schneider’s medium onto a gas-permeable Lumox tissue culture dish (Sarstedt, Newton, NC). Imaging was performed using a Nikon 40×/1.30 NA oil objective on a Nikon Eclipse Ti (Nikon Instruments) with a Yokogawa CSU-X1 spinning disk confocal head (Yokogawa, Life Science) equipped with a Kinetix22 camera (Teledyne Photometrics, Tucson, AZ), 1.5x tube lens, and Nikon Elements software (Nikon Instruments). A Tokai Hit Stage Top Incubator (Tokai Hit USA Inc., Bala Cynwyd, PA) was used to maintain a constant temperature of 25°C throughout imaging. The first focal plane was acquired at the peripodial epithelium. Seven optical slices with 2 µm spacing were acquired every 20s for one hour. The Nikon Perfect Focus System (PFS) was used to continuously monitor the focal plane and make adjustments to keep samples in focus.

Protein in silico Structure Analysis

The coiled-coil regions of DmPACT^WT and DmPACT^ΔR were predicted by submitting the PACT sequence (AA 2634-2780) of PLP (Gene ID: 3772382) to WaggaWagga, which includes Multicoil and NCOILS predictions (Simm et al., 2021). Molecular modeling was carried out using the AlphaFold 3 server (Abramson et al., 2024). The DmPACT^WT and DmPACT^ΔR sequences (AA 2634-2780) and Drosophila calmodulin sequence were used for modeling (Gene ID: 26329). All structural figures were created with PyMOL (Version 3.1.1).

Yeast two-hybrid

PLP interactions were tested using the yeast two-hybrid assay as previously described (Galletta and Rusan, 2015). In brief, cDNA sequences of PLP and PLP-interactor fragments (cloning information listed above) were cloned into pDEST-pGADT7 (Rossignol et al., 2007) and pDEST-PGBKT7-Amp (Galletta et al., 2014) using the Gateway cloning system (Life Technologies) and transformed into Y187 and Y2HGold strains, respectively. The transformants were cultured in either Sd-Leu or Sd-Trp media to select for those carrying the appropriate vector. Strains to be tested for interactions were mated by mixing Y187 and Y2hGold strains in yeast extract + peptone + adenine + dextrose (YPAD) medium overnight at 30ºC with shaking in a flat bottom 96-well plate. Diploids were selected by plating on SD-Leu-Trp dropout media (DDO). Diploids were replicated onto test plates: DDO to control for diploid growth and QDOXA (DDO + Aureobasidin A + X-α-Gal) for interaction tests. Interactions were scored from test plates based on the presence of growth and development of blue color on the QDOXA plate on a scale of 0 (no growth) to 3 (robust growth and blue color).

Immunoprecipitation

Immunoprecipitation (IP) assays were performed using recombinant, purified GFP-Binding Protein (GBP) fused to human Fc domain and bound to magnetic Protein A Dynabeads (ThermoFisher) and then cross-linked with dimethyl pimelimidate. GBP-coupled Dynabeads were stored in PBS, 0.1% Tween 20 at 4°C. Before use, beads were equilibrated in IP buffer (50 mM Tris, pH 7.2, 125 mM NaCl, 1 mM DTT, 0.5% Triton X-100, 1x SigmaFast Protease inhibitors, 0.1 mM PMSF, and 1 μg/mL soybean trypsin inhibitor). Transfected cells were harvested and lysed in IP buffer. Lysate concentration was determined by Bradford assay, and lysates were diluted to 5 mg/mL. Lysates were then clarified by centrifugation at 10,000 x g for 5 min at 4°C. Inputs were made from pre-cleared lysates in Laemmli Buffer. GBP-coated beads were added with lysates and rocked for 30 min at 4°C, followed by four 5-minute washes by resuspending beads in 1 mL IP buffer, and then transferred to a new tube during the final wash, then boiled in 2x Laemmli sample buffer. For the lambda phosphatase treatment, lysates with GBP-coated beads were incubated with lambda phosphatase for 30 min and then boiled in 2x Laemmli sample buffer. Detection by Western Blot utilized anti-V5 (ThermoFisher) and anti-GFP JL-8 (ThermoFisher).

Statistical analysis

Quantified experiments were performed 2 or 3 times to ensure reproducibility. Data analysis and statistics were performed using Excel (Microsoft) and Prism (GraphPad version 10.4.1) software. For comparisons between two groups, unpaired two-tailed t -tests were used, with Welch’s correction when appropriate. One-way ANOVA with Tukey’s correction was used for comparisons between three or more groups. Sample sizes are reported in the figure legends and/or Supplemental File 1. Error bars represent the mean ± SD for all graphs.

Acknowledgements

We thank the NHLBI light microscopy core for assistance with the Zeiss LSM 880 microscope. This work was supported by the Division of Intramural Research at the National Heart, Lung, and Blood Institute (ZIAHL006126 to NMR), the National Institute of General Medical Sciences (R35GM136265 to GCR), and the National Cancer Institute (P30CA23074 to the UACC).

Disclaimer

This research was supported by the Intramural Research Program of the National Institutes of Health (NIH). The contributions of the NIH author(s) are considered Works of the United States Government. The findings and conclusions presented in this paper are those of the author(s) and do not necessarily reflect the views of the NIH or the U.S. Department of Health and Human Services.

Data availability statement

All relevant data can be found within the article and its supplementary information. The DOI for all raw data is 10.25444/nhlbi.30657017

Supplemental material

Figure S1: Head size images and measurements.

Figure S2: Wing images and measurements

Figure S3: Phototaxis assay

Figure S4: PlpΔR does not show gross defects in Johnston’s Organ

Figure S5: Wing imaginal disc mitosis and apoptosis imaging.

Figure S6: Eye/Antennal and leg imaginal disc mitosis and apoptosis imaging.

Figure S7: PlpΔR affects interphase PLP levels at the centriole and total wing disc levels.

Figure S8: PlpΔR impacts PCM recruitment.

Figure S9: AlphaFold3 structural predictions of DmPACT.

Figure S10: PlpΔR affects protein-protein interactions.

Figure S11: AlphaFold3 structural predictions of HsPACT.

Figure S12: PlpΔR affects interaction with Asl.

Supplemental File 1: Numbers of samples measured for all quantifications.

**Figure 1.** PCNT p.Lys3514del is a rare variant linked to MOPD II. A. Common clinical phenotypes of MOPD II. B. All reported PCNT variants categorized according to effect on human health. Pathogenic/Likely Pathogenic variants additionally categorized by variation type and molecular consequence. C. PCNT schematic highlighting the relative locations of disordered regions (pink), the PACT domain (green), and coiled-coil domains (blue). Pathogenic or likely pathogenic variants in PCNT are denoted in red dots by relative position (x-axis) and molecular change (y-axis; Rows 1-20: missense mutations by amino acid; Row 21: large deletions (d); Row 22: single amino acid deletions/frameshifts/premature stop codons (*)). Image is a screenshot from UniProt website (Gene ID: O96513 PCNT_HUMAN, “Variant viewer” tab. Enlarged PACT domain schematic scaled to align with evolutionary comparison of amino acid sequence with Human PCNT^ΔK3154 and Drosophila Plp^ΔR2720 disease variant sequences denoted. Red arrowhead: conserved residue of interest, Lys3154. Blue: non-conserved variant residues. D. Flow chart of PCNT variant selection based on pathogenicity, location of variant within PACT domain, molecular consequence, and conservation. E. Pedigree of the family carrying the human PCNT variant, PCNT^ΔK3154 (Kantaputra et al., 2011; Kantaputra et al., 2004). F. Schematic of the generation of Plp^ΔR2720 using CRISPR. The top line represents the fly genome with E11, E12 and E13 being the last exons of the RF isoform of Plp. Calmodulin binding sites – CBD1, CBD2. The location of the guide RNA for cutting is indicated. The bottom line is the Plp^ΔR2720 repair construct that removes R2720 and introduces a silent change within a StuI site that was used for PCR-based screening.Download

**Figure 2.** Adult tissue characterization of Plp^ΔR mutants. A. Adult heads. 800 µm bars for ease of comparison. B. Adult head width measurements. Additional genotypes in Figure S1. C. Adult wings. D. Wing area (µm²) measurements taken by tracing the margin of the wing from vein L1 to L6. Additional genotypes in Figure S2. E. Schematic of bang assay. The percentage of flies that climbed to upper chamber within 60s is reported. Each point represents the average climbing response from a group of 15-30 flies assayed three times. Ablation = Control fly with arista surgically removed to impair graviception. F. Schematic of mechanosensory assay. Percentage of front leg grooming response is reported. Each point represents the average grooming response from a group of 10 flies assayed three times. Numbers of samples measured are in Supplementary File 1. n.s. = not significant, **** = p ≤ 0.0001.Download

**Figure 6.** PlpΔR disrupts PACT dimerization A. Coiled-coil predictions of DmPACT domain from Waggawagga. CBD1 and 2 are indicated as is the position of R2720. A’. Coiled-coil predication of DmPACTΔR domain. B. AlphaFold3 structural predictions of 2 DmPACTWT + 2 Calmodulin and 2 DmPACTΔR + 2 Calmodulin overlayed with colors to represent predicted coiled-coil regions (green) and regions not predicted to form coiled-coils (red). R2720 in WT and its expected position in the ΔR are indicated by arrows (pink). Residues 2742 and 2780 (black arrows) are used as landmarks to highlight the mispositioning of CBD2 in DmPACTΔR. C. Same structures as B. Color overlay corresponds to AlphaFold3 confidence scores. R2720 in WT and its expected position in the ΔR are indicated by arrows (pink). Residues 2742 and 2780 (black arrows) are used as landmarks to highlight the mispositioning of CBD2 in DmPACTΔR. D. Co-immunoprecipitation is S2 cells showing V5-DmPACT interaction with GFP-DmPACT (red box, left), but not with DmPACT∆R (red box right), HsPACTWT, or HsPACT∆K. Arrowhead highlights slower migrating species. E. Co-immunoprecipitation is S2 cells showing V5- CaM interaction with both DmPACTWT and DmPACT∆R (red box). V5- CaM also interacts with HsPACTWT, and HsPACT∆K F. Co-immunoprecipitation is RPE cells showing V5-HsPACT interaction with GFP-HsPACT, but not with HsPACT∆K, DmPACTWT, or DmPACT∆R. Arrowhead highlights slower migrating species.Download

**Figure 7.** PlpΔR does not interact with Asterless. A. Map of interactome of the C-terminus (green) of PLP from yeast-two hybrid (Y2H; (Galletta et al., 2016). Solid lines represent scoring 2 or 3. Dashed lines scored 1 (Methods). B. Y2H experiment showing interactions of centriole and PCM proteins with PLP(C-term)WT or PLP(C-term)ΔR; the PACT domain resides in this fragment. C. V5-PLP(c-term) co-IPs with Asl-GFP but not with PLP(C-term)ΔR. Note, tight doublet of wild-type PLP(C-term), due to phosphorylation producing the slower migrating species (orange arrow). PLP(C-term)ΔR is not phosphorylated and, thus, the slower migrating band is not observed. D. Immunoprecipitated GFP-DmPACT and GFP-DmPACT∆R, mock or lambda phophatase (λPPase) treated. Arrowheads highlight the two species observed. E. Asterless intensity at metaphase centrosomes normalized to w1118 controls. Numbers of samples measured are in Supplementary File 1. n.s.= not significant. **** p ≤ 0.0001. F. Diagram synthesizing the molecular information gained from this study. The model hypothesizes a molecular pathway that leads from the most basic species (PACT) to a final species of phosphorylated PACT dimer bound to CaM. The exact path taken in cells in unknown (Blue Box), but we presume that a monomer must precede a dimer, and a dimer precedes CaM binding (from this work and Galletta et al., 2014). The final species then promotes PLP interaction with Asl, which is important for setting PLP levels at the centriole, via establishing proper protein levels and / or binding to the centriole. This species at the centriole is also critical for regulating Cnn recruitment.Download

References

1.
Abramson, J., J. Adler, J. Dunger, R. Evans, T. Green, A. Pritzel, O. Ronneberger, L. Willmore, A.J. Ballard, J. Bambrick, S.W. Bodenstein, D.A. Evans, C.-C. Hung, M. O’Neill, D. Reiman, K. Tunyasuvunakool, Z. Wu, A. Zemgulyte, E. Arvaniti, C. Beattie, O. Bertolli, A. Bridgland, A. Cherepanov, M. Congreve, A.I. Cowen-Rivers, A. Cowie, M. Figurnov, F.B. Fuchs, H. Gladman, R. Jain, Y.A. Khan, C.M.R. Low, K. Perlin, A. Potapenko, P. Savy, S. Singh, A. Stecula, A. Thillaisundaram, C. Tong, S. Yakneen, E.D. Zhong, M. Zielinski, A. Zidek, V. Bapst, P. Kohli, M. Jaderberg, D. Hassabis, and J.M. Jumper. 2024. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature. 630:493–500.
2.
Alderton, G.K., L. Galbiati, E. Griffith, K.H. Surinya, H. Neitzel, A.P. Jackson, P.A. Jeggo, and M. O’Driscoll. 2006. Regulation of mitotic entry by microcephalin and its overlap with ATR signalling. Nat Cell Biol. 8:725–733.
3.
Azimzadeh, J., and M. Bornens. 2007. Structure and duplication of the centrosome. Journal of cell science. 120:2139–2142.
4.
Basu, J., H. Bousbaa, E. Logarinho, Z. Li, B.C. Williams, C. Lopes, C.E. Sunkel, and M.L. Goldberg. 1999. Mutations in the essential spindle checkpoint gene bub1 cause chromosome missegregation and fail to block apoptosis in Drosophila. J Cell Biol. 146:13–28.
5.
Bettencourt-Dias, M., F. Hildebrandt, D. Pellman, G. Woods, and S.A. Godinho. 2011. Centrosomes and cilia in human disease. Trends in genetics : TIG. 27:307–315.
6.
Blachon, S., X. Cai, K.A. Roberts, K. Yang, A. Polyanovsky, A. Church, and T. Avidor-Reiss. 2009. A proximal centriole-like structure is present in Drosophila spermatids and can serve as a model to study centriole duplication. Genetics. 182:133–144.
7.
Blachon, S., J. Gopalakrishnan, Y. Omori, A. Polyanovsky, A. Church, D. Nicastro, J. Malicki, and T. Avidor-Reiss. 2008. Drosophila asterless and vertebrate Cep152 Are orthologs essential for centriole duplication. Genetics. 180:2081–2094.
8.
Bober, M.B., and A.P. Jackson. 2017. Microcephalic Osteodysplastic Primordial Dwarfism, Type II: a Clinical Review. Current osteoporosis reports. 15:61–69.
9.
Bober, M.B., N. Khan, J. Kaplan, K. Lewis, J.A. Feinstein, C.I. Scott, Jr., and G.K. Steinberg. 2010. Majewski osteodysplastic primordial dwarfism type II (MOPD II): expanding the vascular phenotype. Am J Med Genet A. 152A:960–965.
10.
Bober, M.B., T. Niiler, A.L. Duker, J.E. Murray, T. Ketterer, M.E. Harley, S. Alvi, C. Flora, C. Rustad, E.M. Bongers, L.S. Bicknell, C. Wise, and A.P. Jackson. 2012. Growth in individuals with Majewski osteodysplastic primordial dwarfism type II caused by pericentrin mutations. Am J Med Genet A. 158A:2719–2725.
11.
Chen, W.-J., F.-C. Huang, and M.-H. Shih. 2019. Ocular characteristics in a variant microcephalic primordial dwarfism type II. BMC pediatrics. 19:329–322.
12.
Conduit, P.T., Z. Feng, J.H. Richens, J. Baumbach, A. Wainman, S.D. Bakshi, J. Dobbelaere, S. Johnson, S.M. Lea, and J.W. Raff. 2014. The centrosome-specific phosphorylation of Cnn by Polo/Plk1 drives Cnn scaffold assembly and centrosome maturation. Dev Cell. 28:659–669.
13.
de Voer, R.M., A. Geurts van Kessel, R.D. Weren, M.J. Ligtenberg, D. Smeets, L. Fu, L. Vreede, E.J. Kamping, E.T. Verwiel, M.M. Hahn, M. Ariaans, L. Spruijt, T. van Essen, G. Houge, H.K. Schackert, J.Q. Sheng, H. Venselaar, C.M. van Ravenswaaij-Arts, J.H. van Krieken, N. Hoogerbrugge, and R.P. Kuiper. 2013. Germline mutations in the spindle assembly checkpoint genes BUB1 and BUB3 are risk factors for colorectal cancer. Gastroenterology. 145:544–547.
14.
de Wolf, B., A. Oghabian, M.V. Akinyi, S. Hanks, E.C. Tromer, J.J.E. van Hooff, L. van Voorthuijsen, L.E. van Rooijen, J. Verbeeren, E.C.H. Uijttewaal, M.P.A. Baltissen, S. Yost, P. Piloquet, M. Vermeulen, B. Snel, B. Isidor, N. Rahman, M.J. Frilander, and G. Kops. 2021. Chromosomal instability by mutations in the novel minor spliceosome component CENATAC. EMBO J. 40:e106536.
15.
Delaval, B., and S.J. Doxsey. 2010. Pericentrin in cellular function and disease. The Journal of cell biology. 188:181–190.
16.
Dictenberg, J.B., W. Zimmerman, C.A. Sparks, A. Young, C. Vidair, Y. Zheng, W. Carrington, F.S. Fay, and S.J. Doxsey. 1998. Pericentrin and gamma-tubulin form a protein complex and are organized into a novel lattice at the centrosome. The Journal of cell biology. 141:163–174.
17.
Diviani, D., L.K. Langeberg, S.J. Doxsey, and J.D. Scott. 2000. Pericentrin anchors protein kinase A at the centrosome through a newly identified RII-binding domain. Current biology : CB. 10:417–420.
18.
Doxsey, S.J. 2005. Molecular links between centrosome and midbody. Molecular cell. 20:170–172.
19.
Duker, A., A. Jackson, and M.B. Bober. 1993. Microcephalic Osteodysplastic Primordial Dwarfism Type II. In GeneReviews(®). M.P. Adam, J. Feldman, G. Mirzaa, R.A. Pagon, S.E. Wallace, and A. Amemiya, editors. University of Washington, Seattle. GeneReviews is a registered trademark of the University of Washington, Seattle. All rights reserved, Seattle (WA).
20.
Duker, A.L., D. Kinderman, C. Jordan, T. Niiler, C.M. Baker-Smith, L. Thompson, D.A. Parry, R.S. Carroll, and M.B. Bober. 2021. Microcephalic osteodysplastic primordial dwarfism type II is associated with global vascular disease. Orphanet J Rare Dis. 16:231.
21.
Endoh-Yamagami, S., K.M. Karkar, S.R. May, I. Cobos, M.T. Thwin, J.E. Long, A.M. Ashique, K. Zarbalis, J.L.R. Rubenstein, and A.S. Peterson. 2010. A mutation in the pericentrin gene causes abnormal interneuron migration to the olfactory bulb in mice. Developmental biology. 340:41–53.
22.
Fang, J., and D.A. Lerit. 2020. Drosophila pericentrin-like protein promotes the formation of primordial germ cells. Genesis. 58:e23347.
23.
Fernandez-Casanas, M., and K.L. Chan. 2018. The Unresolved Problem of DNA Bridging. Genes (Basel). 9.
24.
Fortini, M.E., M.P. Skupski, Boguski, and I.K. Hariharan. 2000. A survey of human disease gene counterparts in the Drosophila genome. The Journal of cell biology. 150:23.
25.
Fu, J., and D.M. Glover. 2012. Structured illumination of the interface between centriole and peri-centriolar material. Open biology. 2:120104.
26.
Galletta, B.J., C.J. Fagerstrom, T.A. Schoborg, T.A. McLamarrah, J.M. Ryniawec, D.W. Buster, K.C. Slep, G.C. Rogers, and N.M. Rusan. 2016. A centrosome interactome provides insight into organelle assembly and reveals a non-duplication role for Plk4. Nature communications. 7:12476.
27.
Galletta, B.J., R.X. Guillen, C.J. Fagerstrom, C.W. Brownlee, D.A. Lerit, T.L. Megraw, G.C. Rogers, and N.M. Rusan. 2014. Drosophila pericentrin requires interaction with calmodulin for its function at centrosomes and neuronal basal bodies but not at sperm basal bodies. Molecular biology of the cell. 25:2682–2694.
28.
Galletta, B.J., J.M. Ortega, S.L. Smith, C.J. Fagerstrom, J.M. Fear, S. Mahadevaraju, B. Oliver, and N.M. Rusan. 2020. Sperm Head-Tail Linkage Requires Restriction of Pericentriolar Material to the Proximal Centriole End. Developmental cell. 53:86–101.e107.
29.
Galletta, B.J., and N.M. Rusan. 2015. A yeast two-hybrid approach for probing protein-protein interactions at the centrosome. Methods in cell biology. 129:251–277.
30.
Gillingham, A.K., and S. Munro. 2000. The PACT domain, a conserved centrosomal targeting motif in the coiled-coil proteins AKAP450 and pericentrin. EMBO reports. 1:524–529.
31.
Gorbsky, G.J., R.H. Chen, and A.W. Murray. 1998. Microinjection of antibody to Mad2 protein into mammalian cells in mitosis induces premature anaphase. J Cell Biol. 141:1193–1205.
32.
Gould, R.R., and G.G. Borisy. 1977. The pericentriolar material in Chinese hamster ovary cells nucleates microtubule formation. The Journal of cell biology. 73:601–615.
33.
Gratz, S.J., A.M. Cummings, J.N. Nguyen, D.C. Hamm, L.K. Donohue, M.M. Harrison, J. Wildonger, and K.M. O’Connor-Giles. 2013. Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics. 194:1029–1035.
34.
Griffith, E., S. Walker, C.-A. Martin, P. Vagnarelli, T. Stiff, B. Vernay, N. Al Sanna, A. Saggar, B. Hamel, W.C. Earnshaw, P.A. Jeggo, A.P. Jackson, and M. O’Driscoll. 2008. Mutations in pericentrin cause Seckel syndrome with defective ATR-dependent DNA damage signaling. Nature genetics. 40:232–236.
35.
Guirgis, M.F., B.L. Lam, and C.W. Howard. 2001. Ocular manifestations of Seckel syndrome. American Journal of Ophthalmology. 132:596–597.
36.
Hall, J.G., C. Flora, C.I. Scott, Jr., R.M. Pauli, and K.I. Tanaka. 2004. Majewski osteodysplastic primordial dwarfism type II (MOPD II): natural history and clinical findings. American journal of medical genetics.Part A. 130A:55–72.
37.
Handke, B., J. Szabad, P.V. Lidsky, E. Hafen, and C.F. Lehner. 2014. Towards long term cultivation of Drosophila wing imaginal discs in vitro. PloS one. 9:e107333.
38.
Hanks, S., K. Coleman, S. Reid, A. Plaja, H. Firth, D. Fitzpatrick, A. Kidd, K. Mehes, R. Nash, N. Robin, N. Shannon, J. Tolmie, J. Swansbury, A. Irrthum, J. Douglas, and N. Rahman. 2004. Constitutional aneuploidy and cancer predisposition caused by biallelic mutations in BUB1B. Nat Genet. 36:1159–1161.
39.
Henrie, A., S.E. Hemphill, N. Ruiz-Schultz, B. Cushman, M.T. DiStefano, D. Azzariti, S.M. Harrison, H.L. Rehm, and K. Eilbeck. 2018. ClinVar Miner: Demonstrating utility of a Web-based tool for viewing and filtering ClinVar data. Human mutation. 39:1051–1060.
40.
Inagaki, H.K., A. Kamikouchi, and K. Ito. 2010. Protocol for quantifying sound-sensing ability of Drosophila melanogaster. Nat Protoc. 5:26–30.
41.
Jiang, X., D.B.T. Ho, K. Mahe, J. Mia, G. Sepulveda, M. Antkowiak, L. Jiang, S. Yamada, and L.E. Jao. 2021. Condensation of pericentrin proteins in human cells illuminates phase separation in centrosome assembly. J Cell Sci. 134.
42.
Jurczyk, A., A. Gromley, S. Redick, J. San Agustin, G. Witman, G.J. Pazour, D.J.M. Peters, and S. Doxsey. 2004. Pericentrin forms a complex with intraflagellar transport proteins and polycystin-2 and is required for primary cilia assembly. The Journal of cell biology. 166:637–643.
43.
Kantaputra, P., P. Tanpaiboon, T. Porntaveetus, A. Ohazama, P. Sharpe, A. Rauch, A. Hussadaloy, and C.T. Thiel. 2011. The smallest teeth in the world are caused by mutations in the PCNT gene. Am J Med Genet A. 155A:1398–1403.
44.
Kantaputra, P.N., P. Tanpaiboon, K. Unachak, and V. Praphanphoj. 2004. Microcephalic osteodysplastic primordial dwarfism with severe microdontia and skin anomalies: confirmation of a new syndrome. American journal of medical genetics.Part A. 130A:181–190.
45.
Kawaguchi, S.-i., and Y. Zheng. 2004. Characterization of a Drosophila centrosome protein CP309 that shares homology with Kendrin and CG-NAP. Molecular biology of the cell. 15:37–45.
46.
Landrum, M.J., J.M. Lee, G.R. Riley, W. Jang, W.S. Rubinstein, D.M. Church, and D.R. Maglott. 2014. ClinVar: public archive of relationships among sequence variation and human phenotype. Nucleic acids research. 42:980.
47.
Lawo, S., M. Hasegan, G.D. Gupta, and L. Pelletier. 2012. Subdiffraction imaging of centrosomes reveals higher-order organizational features of pericentriolar material. Nature cell biology. 14:1148–1158.
48.
Lerit, D.A., H.A. Jordan, J.S. Poulton, C.J. Fagerstrom, B.J. Galletta, M. Peifer, and N.M. Rusan. 2015. Interphase centrosome organization by the PLP-Cnn scaffold is required for centrosome function. The Journal of cell biology. 210:79–97.
49.
Liu, Y., C.F. Nielsen, Q. Yao, and I.D. Hickson. 2014. The origins and processing of ultra fine anaphase DNA bridges. Curr Opin Genet Dev. 26:1–5.
50.
Luders, J. 2012. The amorphous pericentriolar cloud takes shape. Nature cell biology. 14:1126–1128.
51.
Ma, W., and M.M. Viveiros. 2014. Depletion of pericentrin in mouse oocytes disrupts microtubule organizing center function and meiotic spindle organization. Molecular reproduction and development. 81:1019–1029.
52.
Majewski, F., and T. Goecke. 1982. Studies of microcephalic primordial dwarfism I: approach to a delineation of the Seckel syndrome. American Journal of Medical Genetics. 12:7–21.
53.
Majewski, F., M. Stoeckenius, and H. Kemperdick. 1982. Studies of microcephalic primordial dwarfism III: an intrauterine dwarf with platyspondyly and anomalies of pelvis and clavicles–osteodysplastic primordial dwarfism type III. American Journal of Medical Genetics. 12:37–42.
54.
Martinez-Campos, M., R. Basto, J. Baker, M. Kernan, and J.W. Raff. 2004. The Drosophila pericentrin-like protein is essential for cilia/flagella function, but appears to be dispensable for mitosis. The Journal of cell biology. 165:673–683.
55.
Matsuo, K., T. Nishimura, A. Hayakawa, Y. Ono, and M. Takahashi. 2010. Involvement of a centrosomal protein kendrin in the maintenance of centrosome cohesion by modulating Nek2A kinase activity. Biochemical and biophysical research communications. 398:217–223.
56.
Matsuura, S., Y. Matsumoto, K. Morishima, H. Izumi, H. Matsumoto, E. Ito, K. Tsutsui, J. Kobayashi, H. Tauchi, Y. Kajiwara, S. Hama, K. Kurisu, H. Tahara, M. Oshimura, K. Komatsu, T. Ikeuchi, and T. Kajii. 2006. Monoallelic BUB1B mutations and defective mitotic-spindle checkpoint in seven families with premature chromatid separation (PCS) syndrome. Am J Med Genet A. 140:358–367.
57.
Mennella, V., B. Keszthelyi, K.L. McDonald, B. Chhun, F. Kan, G.C. Rogers, B. Huang, and D.A. Agard. 2012. Subdiffraction-resolution fluorescence microscopy reveals a domain of the centrosome critical for pericentriolar material organization. Nature cell biology. 14:1159–1168.
58.
Miyoshi, K., K. Kasahara, I. Miyazaki, S. Shimizu, M. Taniguchi, S. Matsuzaki, M. Tohyama, and M. Asanuma. 2009. Pericentrin, a centrosomal protein related to microcephalic primordial dwarfism, is required for olfactory cilia assembly in mice. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 23:3289–3297.
59.
Muhlhans, J., J.H. Brandstatter, and A. Giessl. 2011. The centrosomal protein pericentrin identified at the basal body complex of the connecting cilium in mouse photoreceptors. PloS one. 6:e26496.
60.
Murphy, T.P., D.D. Luu, J.A. DeSimone, T.C. O’Brien, C.J. Lally, J.J. Lindblad, and S.M. Webster. 2015. A Behavioral Assay for Mechanosensation of MARCM-based Clones in Drosophila melanogaster. Journal of visualized experiments : JoVE. (106):e53537. doi:e53537.
61.
Musacchio, A. 2015. Closing the Mad2 cycle. Elife. 4.
62.
Nigg, E.A., and J.W. Raff. 2009. Centrioles, centrosomes, and cilia in health and disease. Cell. 139:663–678.
63.
Palazzo, R.E., J.M. Vogel, B.J. Schnackenberg, D.R. Hull, and X. Wu. 2000. Centrosome maturation. Current topics in developmental biology. 49:449–470.
64.
Pandey, R., S. Heidmann, and C.F. Lehner. 2005. Epithelial re-organization and dynamics of progression through mitosis in Drosophila separase complex mutants. J Cell Sci. 118:733–742.
65.
Poulton, J.S., J.C. Cuningham, and M. Peifer. 2017. Centrosome and spindle assembly checkpoint loss leads to neural apoptosis and reduced brain size. J Cell Biol. 216:1255–1265.
66.
Purohit, A., S.H. Tynan, R. Vallee, and S.J. Doxsey. 1999. Direct interaction of pericentrin with cytoplasmic dynein light intermediate chain contributes to mitotic spindle organization. The Journal of cell biology. 147:481–492.
67.
Ramdas Nair, A., P. Singh, D. Salvador Garcia, D. Rodriguez-Crespo, B. Egger, and C. Cabernard. 2016. The Microcephaly-Associated Protein Wdr62/CG7337 Is Required to Maintain Centrosome Asymmetry in Drosophila Neuroblasts. Cell Rep. 14:1100–1113.
68.
Rauch, A., C.T. Thiel, D. Schindler, U. Wick, Y.J. Crow, A.B. Ekici, A.J. van Essen, T.O. Goecke, L. Al-Gazali, K.H. Chrzanowska, C. Zweier, H.G. Brunner, K. Becker, C.J. Curry, B. Dallapiccola, K. Devriendt, A. Dorfler, E. Kinning, A. Megarbane, P. Meinecke, R.K. Semple, S. Spranger, A. Toutain, R.C. Trembath, E. Voss, L. Wilson, R. Hennekam, F. de Zegher, H.-G. Dorr, and A. Reis. 2008. Mutations in the pericentrin (PCNT) gene cause primordial dwarfism. Science (New York, N.Y.). 319:816–819.
69.
Robinson, B.V., V. Faundez, and D.A. Lerit. 2020. Understanding microcephaly through the study of centrosome regulation in Drosophila neural stem cells. Biochem Soc Trans. 48:2101–2115.
70.
Rogers, G.C., N.M. Rusan, M. Peifer, and S.L. Rogers. 2008. A multicomponent assembly pathway contributes to the formation of acentrosomal microtubule arrays in interphase Drosophila cells. Mol Biol Cell. 19:3163–3178.
71.
Roque, H., S. Saurya, M.B. Pratt, E. Johnson, and J.W. Raff. 2018. Drosophila PLP assembles pericentriolar clouds that promote centriole stability, cohesion and MT nucleation. PLoS Genet. 14:e1007198.
72.
Rossignol, P., S. Collier, M. Bush, P. Shaw, and J.H. Doonan. 2007. Arabidopsis POT1A interacts with TERT-V(I8), an N-terminal splicing variant of telomerase. Journal of cell science. 120:3678–3687.
73.
Rubin, G.M., M.D. Yandell, J.R. Wortman, G.L. Gabor Miklos, C.R. Nelson, I.K. Hariharan, M.E. Fortini, P.W. Li, R. Apweiler, W. Fleischmann, J. Cherry, S. Henikoff, M.P. Skupski, S. Misra, M. Ashburner, E. Birney, M.S. Boguski, T. Brody, P. Brokstein, S.E. Celniker, S.A. Chervitz, D. Coates, A. Cravchik, A. Gabrielian, R. Galle, W. Gelbart, R. George, L. Goldstein, F. Gong, P. Guan, N.L. Harris, B.A. Hay, R. Hoskins, J. Li, Z. Li, R.O. Hynes, S.J. Jones, P.M. Kuehl, B. Lemaitre, J.T. Littleton, D.K. Morrison, C. Mungall, P. O’Farrell, O.K. Pickeral, C. Shue, L.B. Vosshall, J. Zhang, Q. Zhao, X.H. Zheng, and S. Lewis. 2000. Comparative genomics of the eukaryotes. Science (New York, N.Y.). 287:2204–2215.
74.
Schoborg, T., A.L. Zajac, C.J. Fagerstrom, R.X. Guillen, and N.M. Rusan. 2015. An Asp-CaM complex is required for centrosome-pole cohesion and centrosome inheritance in neural stem cells. J Cell Biol. 211:987–998.
75.
Simm, D., K. Hatje, and M. Kollmar. 2015. Waggawagga: comparative visualization of coiled-coil predictions and detection of stable single alpha-helices (SAH domains). Bioinformatics (Oxford, England). 31:767–769.
76.
Simm, D., K. Hatje, S. Waack, and M. Kollmar. 2021. Critical assessment of coiled-coil predictions based on protein structure data. Scientific reports. 11:12439–w.
77.
Snape, K., S. Hanks, E. Ruark, P. Barros-Nunez, A. Elliott, A. Murray, A.H. Lane, N. Shannon, P. Callier, D. Chitayat, J. Clayton-Smith, D.R. Fitzpatrick, D. Gisselsson, S. Jacquemont, K. Asakura-Hay, M.A. Micale, J. Tolmie, P.D. Turnpenny, M. Wright, J. Douglas, and N. Rahman. 2011. Mutations in CEP57 cause mosaic variegated aneuploidy syndrome. Nat Genet. 43:527–529.
78.
Sonnen, K.F., L. Schermelleh, H. Leonhardt, and E.A. Nigg. 2012. 3D-structured illumination microscopy provides novel insight into architecture of human centrosomes. Biology open. 1:965–976.
79.
Sorino, C., T. Bruno, A. Desantis, M.G. Di Certo, S. Iezzi, F. De Nicola, V. Catena, A. Floridi, L. Chessa, C. Passananti, E. Cundari, and M. Fanciulli. 2013. Centrosomal Che-1 protein is involved in the regulation of mitosis and DNA damage response by mediating pericentrin (PCNT)-dependent Chk1 protein localization. The Journal of biological chemistry. 288:23348–23357.
80.
Spradling, A.C., D. Stern, A. Beaton, E.J. Rhem, T. Laverty, N. Mozden, S. Misra, and G.M. Rubin. 1999. The Berkeley Drosophila Genome Project gene disruption project: Single P-element insertions mutating 25% of vital Drosophila genes. Genetics. 153:135–177.
81.
Srsen, V., N. Gnadt, A. Dammermann, and A. Merdes. 2006. Inhibition of centrosome protein assembly leads to p53-dependent exit from the cell cycle. The Journal of cell biology. 174:625–630.
82.
Stiff, T., T. Casar Tena, M. O’Driscoll, P.A. Jeggo, and M. Philipp. 2016. ATR promotes cilia signalling: links to developmental impacts. Hum Mol Genet. 25:1574–1587.
83.
Takahashi, M., A. Yamagiwa, T. Nishimura, H. Mukai, and Y. Ono. 2002. Centrosomal proteins CG-NAP and kendrin provide microtubule nucleation sites by anchoring gamma-tubulin ring complex. Molecular biology of the cell. 13:3235–3245.
84.
Taylor, S.S., and F. McKeon. 1997. Kinetochore localization of murine Bub1 is required for normal mitotic timing and checkpoint response to spindle damage. Cell. 89:727–735.
85.
Tibelius, A., J. Marhold, H. Zentgraf, C.E. Heilig, H. Neitzel, B. Ducommun, A. Rauch, A.D. Ho, J. Bartek, and A. Kramer. 2009. Microcephalin and pericentrin regulate mitotic entry via centrosome-associated Chk1. J Cell Biol. 185:1149–1157.
86.
Ugur, B., K. Chen, and H.J. Bellen. 2016. Drosophila tools and assays for the study of human diseases. Disease models & mechanisms. 9:235–244.
87.
Varadarajan, R., and N.M. Rusan. 2018. Bridging centrioles and PCM in proper space and time. Essays in biochemistry. 62:793–801.
88.
Varmark, H., S. Llamazares, E. Rebollo, B. Lange, J. Reina, H. Schwarz, and C. Gonzalez. 2007. Asterless is a centriolar protein required for centrosome function and embryo development in Drosophila. Curr Biol. 17:1735–1745.
89.
Wang, Y., T.J. Dantas, P. Lalor, P. Dockery, and C.G. Morrison. 2013. Promoter hijack reveals pericentrin functions in mitosis and the DNA damage response. Cell cycle (Georgetown, Tex.). 12:635–646.
90.
Woodruff, J.B., O. Wueseke, and A.A. Hyman. 2014. Pericentriolar material structure and dynamics. Philosophical transactions of the Royal Society of London.Series B, Biological sciences. 369:20130459. doi: 20130410.20131098/rstb.20132013.20130459.
91.
Yost, S., B. de Wolf, S. Hanks, A. Zachariou, C. Marcozzi, M. Clarke, R. de Voer, B. Etemad, E. Uijttewaal, E. Ramsay, H. Wylie, A. Elliott, S. Picton, A. Smith, S. Smithson, S. Seal, E. Ruark, G. Houge, J. Pines, G. Kops, and N. Rahman. 2017. Biallelic TRIP13 mutations predispose to Wilms tumor and chromosome missegregation. Nat Genet. 49:1148–1151.
92.
Zimmerman, W.C., J. Sillibourne, J. Rosa, and S.J. Doxsey. 2004. Mitosis-specific anchoring of gamma tubulin complexes by pericentrin controls spindle organization and mitotic entry. Molecular biology of the cell. 15:3642–3657.